Generated from notebooks/R-api.ipynb

Using Kipoi from R

Thanks to the reticulate R package from RStudio, it is possible to easily call python functions from R. Hence one can use kipoi python API from R. This tutorial will show how to do that.

Make sure you have git-lfs and Kipoi correctly installed:

  1. Install git-lfs
  2. Install kipoi
    • pip install kipoi

Please read docs/using/getting started before going through this notebook.

Install and load reticulate

Make sure you have the reticulate R package installed

# install.packages("reticulate")
library(reticulate)

Reticulate quick intro

In general, using Kipoi from R is almost the same as using it from Python: instead of using object.method() or object.attribute as in python, use $: object$method(), object$attribute.

# short reticulate example 
os <- import("os")
os$chdir("/tmp")
os$getcwd()

'/tmp'

Type mapping R <-> python

Reticulate translates objects between R and python in the following way:

R Python Examples
Single-element vector Scalar 1, 1L, TRUE, "foo"
Multi-element vector List c(1.0, 2.0, 3.0), c(1L, 2L, 3L)
List of multiple types Tuple list(1L, TRUE, "foo")
Named list Dict list(a = 1L, b = 2.0), dict(x = x_data)
Matrix/Array NumPy ndarray matrix(c(1,2,3,4), nrow = 2, ncol = 2)
Function Python function function(x) x + 1
NULL, TRUE, FALSE None, True, False NULL, TRUE, FALSE

For more info on reticulate, please visit https://github.com/rstudio/reticulate/.

Setup the python environment

With reticulate::py_config() you can check if the python configuration used by reticulate is correct. You can can also choose to use a different conda environment with use_condaenv(...). This comes handy when using different models depending on different conda environments.

reticulate::py_config()
python:         /home/avsec/bin/anaconda3/bin/python
libpython:      /home/avsec/bin/anaconda3/lib/libpython3.6m.so
pythonhome:     /home/avsec/bin/anaconda3:/home/avsec/bin/anaconda3
version:        3.6.3 |Anaconda custom (64-bit)| (default, Oct 13 2017, 12:02:49)  [GCC 7.2.0]
numpy:          /home/avsec/bin/anaconda3/lib/python3.6/site-packages/numpy
numpy_version:  1.14.0
os:             /home/avsec/bin/anaconda3/lib/python3.6/os.py

python versions found: 
 /home/avsec/bin/anaconda3/bin/python
 /usr/bin/python
 /usr/bin/python3

List all conda environments:

reticulate::conda_list()

Create a new conda environment for the model:

$ kipoi env create HAL

Use that environment in R:

reticulate::use_condaenv("kipoi-HAL')

Load kipoi

kipoi <- import("kipoi")

List models

kipoi$list_models()$head()
  source                             model version  \
0  kipoi                      DeepSEAKeras     0.1   
1  kipoi                     extended_coda     0.1   
2  kipoi      DeepCpG_DNA/Hou2016_mESC_dna   1.0.4   
3  kipoi  DeepCpG_DNA/Smallwood2014_2i_dna   1.0.4   
4  kipoi     DeepCpG_DNA/Hou2016_HepG2_dna   1.0.4

                                             authors  \
0  [Author(name='Jian Zhou', github=None, email=N...   
1  [Author(name='Pang Wei Koh', github='kohpangwe...   
2  [Author(name='Christof Angermueller', github='...   
3  [Author(name='Christof Angermueller', github='...   
4  [Author(name='Christof Angermueller', github='...

                                        contributors  \
0  [Author(name='Lara Urban', github='LaraUrban',...   
1  [Author(name='Johnny Israeli', github='jisrael...   
2  [Author(name='Roman Kreuzhuber', github='krrom...   
3  [Author(name='Roman Kreuzhuber', github='krrom...   
4  [Author(name='Roman Kreuzhuber', github='krrom...

                                                 doc   type  \
0  This CNN is based on the DeepSEA model from Zh...  keras   
1  Single bp resolution ChIP-seq denoising - http...  keras   
2  This is the extraction of the DNA-part of the ...  keras   
3  This is the extraction of the DNA-part of the ...  keras   
4  This is the extraction of the DNA-part of the ...  keras

                 inputs                                            targets  \
0                   seq                                     TFBS_DHS_probs   
1  [H3K27AC_subsampled]                                          [H3K27ac]   
2                 [dna]  [cpg/mESC1, cpg/mESC2, cpg/mESC3, cpg/mESC4, c...   
3                 [dna]  [cpg/BS24_1_2I, cpg/BS24_2_2I, cpg/BS24_4_2I, ...   
4                 [dna]  [cpg/HepG21, cpg/HepG22, cpg/HepG23, cpg/HepG2...

   postproc_score_variants license  \
0                     True     MIT   
1                    False     MIT   
2                     True     MIT   
3                     True     MIT   
4                     True     MIT

                                             cite_as  \
0                 https://doi.org/10.1038/nmeth.3547   
1      https://doi.org/10.1093/bioinformatics/btx243   
2  https://doi.org/10.1186/s13059-017-1189-z, htt...   
3  https://doi.org/10.1186/s13059-017-1189-z, htt...   
4  https://doi.org/10.1186/s13059-017-1189-z, htt...

                                          trained_on  \
0  ENCODE and Roadmap Epigenomics chromatin profi...   
1  Described in https://academic.oup.com/bioinfor...   
2  scBS-seq and scRRBS-seq datasets, https://geno...   
3  scBS-seq and scRRBS-seq datasets, https://geno...   
4  scBS-seq and scRRBS-seq datasets, https://geno...

                                  training_procedure  \
0  https://www.nature.com/articles/nmeth.3547#met...   
1  Described in https://academic.oup.com/bioinfor...   
2  Described in https://genomebiology.biomedcentr...   
3  Described in https://genomebiology.biomedcentr...   
4  Described in https://genomebiology.biomedcentr...

                                                tags  
0  [Histone modification, DNA binding, DNA access...  
1                             [Histone modification]  
2                                  [DNA methylation]  
3                                  [DNA methylation]  
4                                  [DNA methylation]

reticulate currently doesn't support direct convertion from pandas.DataFrame to R's data.frame. Let's make a convenience function to create an R dataframe via matrix conversion.

#' List models as an R data.frame
kipoi_list_models <- function() {
    df_models <- kipoi$list_models()
    df <- data.frame(df_models$as_matrix())
    colnames(df) = df_models$columns$tolist()
    return(df)

}
df <- kipoi_list_models()
head(df, 2)
sourcemodelversionauthorscontributorsdoctypeinputstargetspostproc_score_variantslicensecite_astrained_ontraining_proceduretags
kipoi DeepSEAKeras 0.1 <environment: 0x556afc757e38> <environment: 0x556afbb0d538> This CNN is based on the DeepSEA model from Zhou and Troyanskaya (2015). It categorically predicts 918 cell type-specific epigenetic features from DNA sequence. The model is trained on publicly available ENCODE and Roadmap Epigenomics data and on DNA sequences of size 1000bp. The input of the tensor has to be (N, 1000, 4) for N samples, 1000bp window size and 4 nucleotides. Per sample, 918 probabilities of showing a specific epigentic feature will be predicted. keras seq TFBS_DHS_probs TRUE MIT https://doi.org/10.1038/nmeth.3547 ENCODE and Roadmap Epigenomics chromatin profiles https://www.nature.com/articles/nmeth.3547#methods https://www.nature.com/articles/nmeth.3547#methods <environment: 0x556afcddfd50>
kipoi extended_coda 0.1 <environment: 0x556afc764260> <environment: 0x556afbaff708> Single bp resolution ChIP-seq denoising - https://github.com/kundajelab/coda keras H3K27AC_subsampled H3K27ac FALSE MIT https://doi.org/10.1093/bioinformatics/btx243 Described in https://academic.oup.com/bioinformatics/article/33/14/i225/3953958#100805343Described in https://academic.oup.com/bioinformatics/article/33/14/i225/3953958#100805343<environment: 0x556afcde7f60>

Get the kipoi model and make a prediction for the example files

To run the following example, make sure you have all the dependencies installed. Run:

kipoi$install_model_requirements("MaxEntScan/3prime")

from R or

kipoi env create MaxEntScan
source activate kipoi-MaxEntScan

from the command-line. This will install all the required dependencies for both, the model and the dataloader.

kipoi$install_model_requirements("MaxEntScan/3prime")
model <- kipoi$get_model("MaxEntScan/3prime")
predictions <- model$pipeline$predict_example()
head(predictions)
  1. 6.72899227874919
  2. 6.15729433240656
  3. 7.14095214875511
  4. 2.13760519765451
  5. -9.52033554891735
  6. 9.54342300799607

Use the model and dataloader independently

# Get the dataloader
setwd('~/.kipoi/models/MaxEntScan/3prime')

dl <- model$default_dataloader(gtf_file='example_files/hg19.chr22.gtf', fasta_file='example_files/hg19.chr22.fa')
# get a batch iterator
it <- dl$batch_iter(batch_size=4)
it
DataLoaderIter
# Retrieve a batch of data
batch <- iter_next(it)
str(batch)
List of 2
 $ inputs  : chr [1:4(1d)] "TCTTCTCTCCCCAATCTCAGCCT" "ATTCTCAGTTGTCTTTACAGTTT" "CCTTAGTTTTATTTTTTCAGAGT" "ATTTTTGTTTTTAGACATAGGAT"
 $ metadata:List of 5
  ..$ geneID      : chr [1:4(1d)] "ENSG00000233866" "ENSG00000223875" "ENSG00000223875" "ENSG00000223875"
  ..$ transcriptID: chr [1:4(1d)] "ENST00000424770" "ENST00000420638" "ENST00000420638" "ENST00000420638"
  ..$ biotype     : chr [1:4(1d)] "lincRNA" "pseudogene" "pseudogene" "pseudogene"
  ..$ order       : num [1:4(1d)] 0 0 1 2
  ..$ ranges      :List of 5
  .. ..$ chr   : chr [1:4(1d)] "22" "22" "22" "22"
  .. ..$ start : num [1:4(1d)] 16062790 16118910 16101471 16100645
  .. ..$ end   : num [1:4(1d)] 16062813 16118933 16101494 16100668
  .. ..$ id    : chr [1:4(1d)] "ENSG00000233866" "ENSG00000223875" "ENSG00000223875" "ENSG00000223875"
  .. ..$ strand: chr [1:4(1d)] "+" "-" "-" "-"
# make the prediction with a model
model$predict_on_batch(batch$inputs)
  1. 6.72899227874919
  2. 6.15729433240656
  3. 7.14095214875511
  4. 2.13760519765451

Troubleshooting

Since Kipoi is not natively implemented in R, the error messages are cryptic and hence debugging can be a bit of a pain.

Run the same code in python or CLI

When you encounter an error, try to run the analogous code snippet from the command line or python. A good starting point is to first run

$ kipoi test MaxEntScan/3prime --source=kipoi

from the command-line first.

Dependency issues

It's very likely that the error will be due to missing dependencies. Also note that some models will work only with python 3 or python 2. To install all the required dependencies for the model, run:

$ kipoi env create MaxEntScan
$ source activate kipoi-MaxEntScan

This will install the dependencies into your current conda environment. If you wish to create a new environment with all the dependencies installed, run

$ kipoi env create MaxEntScan
$ source activate kipoi-MaxEntScan

To use that environment in R, run:

use_condaenv("kipoi-MaxEntScan__3prime")

Make sure you run that code snippet right after importing the reticulate library (i.e. make sure you run it before kipoi <- import('kipoi'))

Float/Double type issues

When using a pytorch model: DeepSEA/predict

kipoi$install_model_requirements("DeepSEA/predict")
# Get the dataloader
setwd('~/.kipoi/models/DeepSEA/predict')
model <- kipoi$get_model("DeepSEA/predict")
dl <- model$default_dataloader(intervals_file='example_files/intervals.bed', fasta_file='example_files/hg38_chr22.fa')
# get a batch iterator
it <- dl$batch_iter(batch_size=4)
# predict for a batch
batch <- iter_next(it)
# model$predict_on_batch(batch$inputs)

We get an error:

Error in py_call_impl(callable, dots$args, dots$keywords): RuntimeError: Input type (CUDADoubleTensor) and weight type (CUDAFloatTensor) should be the same

This means that the feeded array is Double instead of Float.

R arrays are by default converted to float64 numpy dtype:

np <- import("numpy", convert=FALSE)
np$array(0.1)$dtype
float64
np$array(batch$inputs)$dtype
float64

To fix this, we need to explicitly convert them to float32 before passing the batch to the model:

model$predict_on_batch(np$array(batch$inputs, dtype='float32'))
0.003497796 0.003443634 0.00475722 0.006346597 0.01217456 0.008442441 0.005778539 0.007471715 0.005652952 0.009384833 ⋯ 0.00037174530.001310135 0.01009644 0.008201431 0.00043815370.007473897 0.009021533 0.003500142 0.003842842 0.0003947651
0.003497796 0.003443634 0.00475722 0.006346597 0.01217456 0.008442441 0.005778539 0.007471715 0.005652952 0.009384833 ⋯ 0.00037174530.001310135 0.01009644 0.008201431 0.00043815370.007473897 0.009021533 0.003500142 0.003842842 0.0003947651
0.003497796 0.003443634 0.00475722 0.006346597 0.01217456 0.008442441 0.005778539 0.007471715 0.005652952 0.009384833 ⋯ 0.00037174530.001310135 0.01009644 0.008201431 0.00043815370.007473897 0.009021533 0.003500142 0.003842842 0.0003947651
0.003497796 0.003443634 0.00475722 0.006346597 0.01217456 0.008442441 0.005778539 0.007471715 0.005652952 0.009384833 ⋯ 0.00037174530.001310135 0.01009644 0.008201431 0.00043815370.007473897 0.009021533 0.003500142 0.003842842 0.0003947651